أسئلة أحياء لغات

[physiology]

Which of the following is an example of complementary base pairing?
A. guanine—uracil
B. adenine—cytosine
C. cytosine—thymine
D. cytosine—guanine

What structure prevents food from entering the trachea?
A. the tongue
B. the pharynx
C. the epiglottis
D. the cardiac sphincter

Which is a function of the large intestine?
A. the secretion of bile
B. the absorption of vitamins
C. the production of glycogen
D. the release of sodium bicarbonate

Which enzyme functions optimally in a low pH?
A. lipase
B. pepsin
C. trypsin
D. amylase

The removal of the gall bladder would affect the rate of digestion of which of the following?
A. lipids
B. proteins
C. nucleotides
D. carbohydrates

Cilia in the trachea sweep debris toward which of the following structures?
A. the alveoli
B. the bronchi
C. the pharynx
D. the bronchioles

Urine enters the bladder through which structure?
A. the ureter
B. the kidney
C. the urethra
D. the collecting duct

What structure secretes aldosterone?
A. the adrenal gland
B. the hypothalamus
C. the pituitary gland
D. the medulla oblongata

Which of the following structures secretes testosterone?
A. the prostate
B. the epididymis
C. the vas deferens
D. the interstitial cells

What type of molecule is adenosine triphosphate (ATP)?
A. a fat
B. a steroid
C. a protein
D. a nucleotide

Where is blood velocity the slowest?
A. in a vein
B. in a venule
C. in an artery
D. in a capillary


What part of the brain controls the release of hormones from the pituitary gland?
A. the thalamus
B. the cerebrum
C. the hypothalamus
D. the corpus callosum

During which process would adenine bond with thymine but not uracil?
A. translation
B. replication
C. transcription
D. dehydration synthesis

Consider the following portion of an mRNA strand:
UAC GGG AUA
What are the anticodons that will be paired to this strand?
A. AT G CCC TAT
B. AT A GGG TAC
C. AUG CCC UAU
D. UAC GGG AUA

What is the function of thyroxin?
A. to cause ovulation
B. to increase metabolic rate
C. to decrease the rate of digestion
D. to control the concentration of sodium ions in the blood


What two structures produce chemicals that digest proteins?
A. the liver and the pancreas
B. the salivary and intestinal glands
C. the gastric glands and the pancreas
D. the gastric glands and the gall bladder

3. Using the genetic code table, complete the following: (3 pts)
Genetic code (DNA code) of a gene is: ATGCCGTTGATTACTCAAGCCTGA

a) What will be the sequence of the mRNA? __________________________________________________ _____

What will be the amino acid sequence of a protein produced from this? __________________________________________________ ____________

c) Due to mutation, the above genetic code has been changed to: ATGCCCGTTGATTACTCAAGCCTTG. What kind of mutation is this called?

[فتاة_الإسلام]

شكراً جزيلاً يا أستاذ فسيولوجي على الأسئلة، بس ياريت حضرتك تحط إجاباتها عشان نتأكد من إجاباتنا صح ولا غلط

[physiology]

يفضل أن تكون الأسئلة بدون إجابة عشان أي طالب يحتاج أسئلة يفكر فيها يلقى الأسئلة دي ولو سؤال مش واضح يسأل عليه في رساله خاصة لأن السؤال اللي هو مش عارفه مش بالضرورة يكون الكل زيه .
ولذلك إذا كنتي تحتاجي لإجابات أسئلة معينة قولي لي عليها وأنا أرسلك حلها.

[مس امل]

يا ريت يكون فية اكتر ويا ريت تكون فيه ترجمة الامتحانت للاحياء

[andrew kamal]

جهد مشكوررررر جداااااا

[dentist do]

Dzakh God all good and Dzana examples of